Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 35491656 35492052 vista61855

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 35491824 rs542631147 TAGTCCCAGCAACTCAGGAGGCTGA T 11003755

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results