EnhancerDB
  1. Home
  2. TFBS
  3. NFKB1[chr16:12912099-12912110]
Chromosome characteristics of NFKB1[chr16:12912099-12912110]
Back to top
Enhancers possibly regulated by NFKB1[chr16:12912099-12912110]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 12908185 12915435 enh16565
Placenta Liver (HepG2) Lung (PC-9)
SNP sites on NFKB1[chr16:12912099-12912110]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 12912108 rs140907635 CCCTGTCTCTACTAAAAATA C 4334441
chr16 12912108 rs72209117 CCCTGTCTCTACTAAAAATA C 4334442
Genes possibly regulated by NFKB1[chr16:12912099-12912110]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFKB1[chr16:12912099-12912110]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results