-
Home
- TFBS
- POU2F1[chr16:12926509-12926521]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr16 |
12925854 |
12930955 |
enh81091 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr16
|
12926513
|
rs528490720
|
A
|
ATGTATATGTATATGTATAT
|
4334516
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |