Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 17671189 17675511 enh94275

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 17671722 rs559737577 CTTCTCACTCATCCAGCAAAA C 4357283

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results