Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 19184965 19189495 enh16589

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 19186098 rs368718597 T TGGAAAAGTAGATAGGAATGC 4360883

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results