| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 20606165 | 20615835 | enh52236 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 20613308 | rs566342043 | ATATATATGTATACATACACATATT | A | 4366463 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|