Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20606165 20615835 enh52236

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20613308 rs566342043 ATATATATGTATACATACACATATT A 4366463
chr16 20613314 rs199875872 A G 4366464

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results