Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 10233485 10240795 enh84087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 10233817 rs528959736 AATTGGTTTATTGTTAGAAAATTG A 8821959

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results