Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 12273445 12282975 enh84090

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 12281740 rs148713958 T TGGGGAAAGGCAGAGAGAGGCTAAGTGC 8837498

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results