EnhancerDB
  1. Home
  2. Gene
  3. ZNF354C[ENSG00000177932.6]
Enhancers that regulate ZNF354C[ENSG00000177932.6]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr5 178476905 178481055 enh22870 178487416 6361
Placenta
chr5 178567744 178572791 enh38700 178487416 80328
Muscle (Myoblast) Astrocyte Peripheral Blood (MM.1S) Bone (Osteoblast)
Transcript facotrs that regulate ZNF354C[ENSG00000177932.6]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with ZNF354C[ENSG00000177932.6], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr5 178801421 rs34604246 A C 290883 Heart 0.152366 8743881
chr5 179038535 rs71001013 T TCTGCCTCCTGGGTTCAAGCAATTCTCCC 527997 Pancreas 0.249788 8745426
chr5 177668046 rs10039093 G A 819370 Ovary 0.315052 8735407
chr5 178115306 rs72810690 C A 372110 Thyroid 0.0842381 8739341
chr5 179484838 rs7734329 C A,T 974300 Stomach 0.218019 8747039
Details of ZNF354C[ENSG00000177932.6]
Back to top
Genomic Location chr5:178487416-178510538[+]
TSS 178487416
Gene Name ZNF354C
Ensembl ID ENSG00000177932.6
ENTREZID 30832
Uniprot
Q86Y25
Protein Name
Zinc finger protein 354C
Expression levels of ZNF354C[ENSG00000177932.6]
Back to top