| p-value: | 1e-2 |
| log p-value: | -5.704e+00 |
| Information Content per bp: | 1.922 |
| Number of Target Sequences with motif | 3.0 |
| Percentage of Target Sequences with motif | 42.86% |
| Number of Background Sequences with motif | 8973.8 |
| Percentage of Background Sequences with motif | 4.79% |
| Average Position of motif in Targets | 49.6 +/- 19.0bp |
| Average Position of motif in Background | 99.3 +/- 111.2bp |
| Strand Bias (log2 ratio + to - strand density) | 2.0 |
| Multiplicity (# of sites on avg that occur together) | 1.67 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PB0192.1_Tcfap2e_2/Jaspar
| Match Rank: | 1 |
| Score: | 0.68 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----GAAAAGAG- TACTGGAAAAAAAA |
|
|
|
NFATC2/MA0152.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.67 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GAAAAGAG TGGAAAA--- |
|
|
|
Sox4(HMG)/proB-Sox4-ChIP-Seq(GSE50066)/Homer
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GAAAAGAG- GGAACAAAGR |
|
|
|
GATA6/MA1104.2/Jaspar
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GAAAAGAG-- NNAGATAAGATAN |
|
|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GAAAAGAG------ TTTTTAGAGATAAGAAATAAAG |
|
|
|
Foxo1/MA0480.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GAAAAGAG-- TGTAAACAGGA |
|
|
|
NFAT5/MA0606.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----GAAAAGAG NATGGAAAAN-- |
|
|
|
Gata6(Zf)/HUG1N-GATA6-ChIP-Seq(GSE51936)/Homer
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GAAAAGAG NVAGATAAGR- |
|
|
|
Foxo1(Forkhead)/RAW-Foxo1-ChIP-Seq(Fan_et_al.)/Homer
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | GAAAAGAG GTAAACAG |
|
|
|
ZNF384/MA1125.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.62 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GAAAAGAG- TTTAAAAAAAAA |
|
|
|