| p-value: | 1e-6 |
| log p-value: | -1.396e+01 |
| Information Content per bp: | 1.957 |
| Number of Target Sequences with motif | 4.0 |
| Percentage of Target Sequences with motif | 30.77% |
| Number of Background Sequences with motif | 418.2 |
| Percentage of Background Sequences with motif | 0.60% |
| Average Position of motif in Targets | 121.5 +/- 38.7bp |
| Average Position of motif in Background | 102.6 +/- 84.5bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
NEUROG2(var.2)/MA1642.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----AGATGGGT GGAACAGATGGCA |
|
|
|
NEUROD1/MA1109.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.73 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----AGATGGGT- GGACAGATGGCAG |
|
|
|
NeuroG2(bHLH)/Fibroblast-NeuroG2-ChIP-Seq(GSE75910)/Homer
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGATGGGT AACAGATGGT- |
|
|
|
NeuroD1(bHLH)/Islet-NeuroD1-ChIP-Seq(GSE30298)/Homer
| Match Rank: | 4 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGATGGGT AACAGATGGC- |
|
|
|
HAND2/MA1638.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---AGATGGGT ACCAGATGGC- |
|
|
|
ZFP42/MA1651.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.66 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AGATGGGT------- GTTCCAAAATGGCTGCCTCCG |
|
|
|
TCF4(bHLH)/SHSY5Y-TCF4-ChIP-Seq(GSE96915)/Homer
| Match Rank: | 7 |
| Score: | 0.66 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGATGGGT DMCAGATGKS- |
|
|
|
YY1/MA0095.2/Jaspar
| Match Rank: | 8 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AGATGGGT-- CAAGATGGCGGC |
|
|
|
PB0193.1_Tcfe2a_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.65 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AGATGGGT--- AAGGCCAGATGGTCCGG |
|
|
|
TWIST1/MA1123.2/Jaspar
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----AGATGGGT ATTCCAGATGTTT |
|
|
|