| p-value: | 1e-2 |
| log p-value: | -5.613e+00 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 1.0 |
| Percentage of Target Sequences with motif | 8.33% |
| Number of Background Sequences with motif | 25.3 |
| Percentage of Background Sequences with motif | 0.03% |
| Average Position of motif in Targets | 146.0 +/- 0.0bp |
| Average Position of motif in Background | 77.6 +/- 69.2bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PB0094.1_Zfp128_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.61 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GATCGTAC----- TCTTTGGCGTACCCTAA |
|
|
|
HOXC12/MA0906.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.60 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- GGTCGTAAAAA |
|
|
|
HOXC11/MA0651.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.59 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- GGTCGTAAAAT |
|
|
|
HOXA9/MA0594.2/Jaspar
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- -GTCGTAAACG |
|
|
|
HOXD10/MA1506.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- GGTCGTAAAAC |
|
|
|
PH0067.1_Hoxc12/Jaspar
| Match Rank: | 6 |
| Score: | 0.58 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GATCGTAC------ TTAGGTCGTAAAATTTC |
|
|
|
HOXD12/MA0873.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.58 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- AGTCGTAAAAA |
|
|
|
Hoxa11/MA0911.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.57 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC---- GGTCGTAAAATT |
|
|
|
HOXD11/MA0908.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GATCGTAC--- -GTCGTAAAAA |
|
|
|
PB0125.1_Gata3_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GATCGTAC------- TTTTGTAGATTTTATCGACTTA |
|
|
|