| p-value: | 1e-5 |
| log p-value: | -1.282e+01 |
| Information Content per bp: | 1.796 |
| Number of Target Sequences with motif | 34.0 |
| Percentage of Target Sequences with motif | 3.21% |
| Number of Background Sequences with motif | 633.7 |
| Percentage of Background Sequences with motif | 1.31% |
| Average Position of motif in Targets | 107.8 +/- 56.0bp |
| Average Position of motif in Background | 100.8 +/- 52.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.5 |
| Multiplicity (# of sites on avg that occur together) | 1.06 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
GATA1/MA0035.4/Jaspar
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA- NNAGATTAGAN |
|
|
|
PB0139.1_Irf5_2/Jaspar
| Match Rank: | 2 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AGACGAGA----- TTGACCGAGAATTCC |
|
|
|
Mecom/MA0029.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AGACGAGA----- AAGATAAGATAACA |
|
|
|
Smad3(MAD)/NPC-Smad3-ChIP-Seq(GSE36673)/Homer
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA BCAGACWA-- |
|
|
|
Smad4(MAD)/ESC-SMAD4-ChIP-Seq(GSE29422)/Homer
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA CCAGACRSVB |
|
|
|
GATA6/MA1104.2/Jaspar
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA--- NNAGATAAGATAN |
|
|
|
PB0138.1_Irf4_2/Jaspar
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA----- GNNACCGAGAATNNN |
|
|
|
Smad2(MAD)/ES-SMAD2-ChIP-Seq(GSE29422)/Homer
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGACGAGA CCAGACAG-- |
|
|
|
PB0106.1_Arid5a_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.61 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AGACGAGA--- CATACAATACGAAATAA |
|
|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.60 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------AGACGAGA------- TTTTTAGAGATAAGAAATAAAG |
|
|
|