| p-value: | 1e-4 |
| log p-value: | -1.033e+01 |
| Information Content per bp: | 1.892 |
| Number of Target Sequences with motif | 10.0 |
| Percentage of Target Sequences with motif | 90.91% |
| Number of Background Sequences with motif | 23950.7 |
| Percentage of Background Sequences with motif | 28.87% |
| Average Position of motif in Targets | 122.0 +/- 55.1bp |
| Average Position of motif in Background | 98.9 +/- 87.4bp |
| Strand Bias (log2 ratio + to - strand density) | -0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.40 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
RBPJ/MA1116.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTACCAAC NNTTCCCANN |
|
|
|
PB0150.1_Mybl1_2/Jaspar
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTACCAAC------- CGACCAACTGCCGTG |
|
|
|
Hic1/MA0739.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.64 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTACCAAC- ATGCCAACC |
|
|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TTACCAAC------- TGTGACCCTTAGCAACCGATTAA |
|
|
|
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TTACCAAC--- CCGCATAGCAACGGA |
|
|
|
NFIA/MA0670.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TTACCAAC- GGTGCCAAGT |
|
|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TTACCAAC--- TACCATAGCAACGGT |
|
|
|
RFX7/MA1554.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACCAAC- NTAGCAACG |
|
|
|
ZNF75D/MA1601.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACCAAC-- TTTCCCACAN |
|
|
|
PB0149.1_Myb_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTACCAAC-------- CGACCAACTGCCATGC |
|
|
|