| p-value: | 1e-5 |
| log p-value: | -1.191e+01 |
| Information Content per bp: | 1.948 |
| Number of Target Sequences with motif | 56.0 |
| Percentage of Target Sequences with motif | 5.24% |
| Number of Background Sequences with motif | 1327.3 |
| Percentage of Background Sequences with motif | 2.77% |
| Average Position of motif in Targets | 102.0 +/- 55.7bp |
| Average Position of motif in Background | 100.7 +/- 58.0bp |
| Strand Bias (log2 ratio + to - strand density) | 0.7 |
| Multiplicity (# of sites on avg that occur together) | 1.31 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
ETV4/MA0764.2/Jaspar
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GAAGAAGG- ACAGGAAGTG |
|
|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 2 |
| Score: | 0.69 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | GAAGAAGG --NGAAGC |
|
|
|
PU.1(ETS)/ThioMac-PU.1-ChIP-Seq(GSE21512)/Homer
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GAAGAAGG- AGAGGAAGTG |
|
|
|
PB0124.1_Gabpa_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.66 |
| Offset: | -8 |
| Orientation: | reverse strand |
| Alignment: | --------GAAGAAGG NNNNGGGGGAAGANGG |
|
|
|
SPI1/MA0080.5/Jaspar
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------GAAGAAGG------ AAAAAAGAGGAAGTGAAAAA |
|
|
|
ELF3(ETS)/PDAC-ELF3-ChIP-Seq(GSE64557)/Homer
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GAAGAAGG ANCAGGAAGT |
|
|
|
ZNF467(Zf)/HEK293-ZNF467.GFP-ChIP-Seq(GSE58341)/Homer
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GAAGAAGG--- TGGGGAAGGGCM |
|
|
|
SPIB/MA0081.2/Jaspar
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----GAAGAAGG---- NAAAGAGGAAGTGANA |
|
|
|
PRDM1/MA0508.3/Jaspar
| Match Rank: | 9 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GAAGAAGG- NAGAGAAAGNA |
|
|
|
PB0058.1_Sfpi1_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GAAGAAGG-- TTAAGAGGAAGTTA |
|
|
|