| p-value: | 1e-5 |
| log p-value: | -1.161e+01 |
| Information Content per bp: | 1.911 |
| Number of Target Sequences with motif | 6.0 |
| Percentage of Target Sequences with motif | 40.00% |
| Number of Background Sequences with motif | 2409.2 |
| Percentage of Background Sequences with motif | 3.66% |
| Average Position of motif in Targets | 159.2 +/- 43.2bp |
| Average Position of motif in Background | 98.8 +/- 73.2bp |
| Strand Bias (log2 ratio + to - strand density) | 2.8 |
| Multiplicity (# of sites on avg that occur together) | 1.33 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
GRHL2/MA1105.2/Jaspar
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AAAAGGCT-- AAAACAGGTTTT |
|
|
|
HLTF/MA0109.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AAAAGGCT NNATAAGGNN |
|
|
|
MYNN(Zf)/HEK293-MYNN.eGFP-ChIP-Seq(Encode)/Homer
| Match Rank: | 3 |
| Score: | 0.65 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------AAAAGGCT TTCAAAWTAAAAGTC- |
|
|
|
TATA-Box(TBP)/Promoter/Homer
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------AAAAGGCT GNCTATAAAAGG-- |
|
|
|
ZFP42/MA1651.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.62 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AAAAGGCT------- GTTCCAAAATGGCTGCCTCCG |
|
|
|
MAFF/MA0495.3/Jaspar
| Match Rank: | 6 |
| Score: | 0.60 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AAAAGGCT----- NNNAAAATGCTGACTN |
|
|
|
Nur77(NR)/K562-NR4A1-ChIP-Seq(GSE31363)/Homer
| Match Rank: | 7 |
| Score: | 0.60 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AAAAGGCT- ANGNAAAGGTCA |
|
|
|
POL010.1_DCE_S_III/Jaspar
| Match Rank: | 8 |
| Score: | 0.59 |
| Offset: | 4 |
| Orientation: | reverse strand |
| Alignment: | AAAAGGCT- ----NGCTN |
|
|
|
LEF1(HMG)/H1-LEF1-ChIP-Seq(GSE64758)/Homer
| Match Rank: | 9 |
| Score: | 0.59 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----AAAAGGCT ASATCAAAGG-- |
|
|
|
NR4A1/MA1112.2/Jaspar
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AAAAGGCT--- TTAAAGGTCAAA |
|
|
|