| p-value: | 1e-6 |
| log p-value: | -1.563e+01 |
| Information Content per bp: | 1.805 |
| Number of Target Sequences with motif | 139.0 |
| Percentage of Target Sequences with motif | 14.90% |
| Number of Background Sequences with motif | 4663.1 |
| Percentage of Background Sequences with motif | 9.58% |
| Average Position of motif in Targets | 97.4 +/- 55.9bp |
| Average Position of motif in Background | 99.8 +/- 59.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.09 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PRDM14(Zf)/H1-PRDM14-ChIP-Seq(GSE22767)/Homer
| Match Rank: | 1 |
| Score: | 0.63 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ATAGAGAT-- GGTTAGAGACCT |
|
|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.62 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ATAGAGAT----------- TTTTTAGAGATAAGAAATAAAG |
|
|
|
PB0126.1_Gata5_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.61 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAGAGAT-------- GACAGAGATATCAGTGT |
|
|
|
PB0139.1_Irf5_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.60 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ATAGAGAT---- TTGACCGAGAATTCC |
|
|
|
GATA3(Zf)/iTreg-Gata3-ChIP-Seq(GSE20898)/Homer
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | 4 |
| Orientation: | forward strand |
| Alignment: | ATAGAGAT---- ----AGATAASR |
|
|
|
ZNF768(Zf)/Rajj-ZNF768-ChIP-Seq(GSE111879)/Homer
| Match Rank: | 6 |
| Score: | 0.58 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --ATAGAGAT-- RHHCAGAGAGGB |
|
|
|
Ptf1a/MA1618.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.57 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | ATAGAGAT----- AAACAGATGTTTA |
|
|
|
PB0023.1_Gata6_1/Jaspar
| Match Rank: | 8 |
| Score: | 0.57 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAGAGAT-------- TATAGAGATAAGAATTG |
|
|
|
GATA2/MA0036.3/Jaspar
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | ATAGAGAT----- --NNAGATAAGNN |
|
|
|
HNF6(Homeobox)/Liver-Hnf6-ChIP-Seq(ERP000394)/Homer
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | ATAGAGAT-- NTATYGATCH |
|
|
|