| p-value: | 1e-5 |
| log p-value: | -1.357e+01 |
| Information Content per bp: | 1.902 |
| Number of Target Sequences with motif | 6.0 |
| Percentage of Target Sequences with motif | 60.00% |
| Number of Background Sequences with motif | 3398.6 |
| Percentage of Background Sequences with motif | 4.39% |
| Average Position of motif in Targets | 103.0 +/- 62.2bp |
| Average Position of motif in Background | 102.7 +/- 73.1bp |
| Strand Bias (log2 ratio + to - strand density) | -1.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.73 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CATAGGAA---- CCGCATAGCAACGGA |
|
|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CATAGGAA---- TACCATAGCAACGGT |
|
|
|
RFX1/MA0509.2/Jaspar
| Match Rank: | 3 |
| Score: | 0.72 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CATAGGAA--- TNCCATAGCAACNN |
|
|
|
PB0115.1_Ehf_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.71 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CATAGGAA------ AAGATCGGAANTNNNA |
|
|
|
Ets1-distal(ETS)/CD4+-PolII-ChIP-Seq(Barski_et_al.)/Homer
| Match Rank: | 5 |
| Score: | 0.71 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CATAGGAA-- AACAGGAAGT |
|
|
|
ETV4/MA0764.2/Jaspar
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CATAGGAA--- -ACAGGAAGTG |
|
|
|
RFX3/MA0798.2/Jaspar
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CATAGGAA--- TNCCATAGCAACNN |
|
|
|
Rfx5(HTH)/GM12878-Rfx5-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 8 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CATAGGAA--- SCCTAGCAACAG |
|
|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.69 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CATAGGAA-------- TGTGACCCTTAGCAACCGATTAA |
|
|
|
IKZF1/MA1508.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CATAGGAA-- GAAACAGGAAGT |
|
|
|