EnhancerDB
  1. Home
  2. Enhancers
  3. vista17789[chr14:53392802-53392977]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista17789[chr14:53392802-53392977]
Back to top
Tissue distribution of vista17789
Back to top
Transcription factor that possibly regulate vista17789[chr14:53392802-53392977]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr14 53392799 53392805 ZNF354C JASPAR yes 107549669
chr14 53392799 53392805 ZNF354C JASPAR yes 115384879
chr14 53392807 53392812 MYB TRANSFAC yes 107549670
chr14 53392807 53392812 MYB TRANSFAC yes 115384880
chr14 53392816 53392823 SPIB JASPAR yes 107549671
chr14 53392816 53392823 SPIB JASPAR yes 115384881
chr14 53392850 53392868 MAFF JASPAR yes 107549672
chr14 53392850 53392868 MAFF JASPAR yes 115384882
chr14 53392851 53392855 YY1 TRANSFAC yes 107549673
chr14 53392851 53392855 YY1 TRANSFAC yes 115384883
chr14 53392852 53392863 NRL JASPAR yes 107549674
chr14 53392852 53392863 NRL JASPAR yes 115384884
chr14 53392852 53392867 MAFK JASPAR yes 107549675
chr14 53392852 53392867 MAFK JASPAR yes 115384885
chr14 53392856 53392867 DUX4 JASPAR yes 107549676
chr14 53392856 53392867 DUX4 JASPAR yes 115384886
chr14 53392869 53392876 NKX3-1 JASPAR yes 107549677
chr14 53392869 53392876 NKX3-1 JASPAR yes 115384887
chr14 53392887 53392901 IRF7 JASPAR yes 107549678
chr14 53392887 53392901 IRF7 JASPAR yes 115384888
chr14 53392891 53392904 POU2F2 JASPAR yes 107549679
chr14 53392891 53392904 POU2F2 JASPAR yes 115384889
chr14 53392904 53392915 DMRT3 JASPAR yes 107549680
chr14 53392904 53392915 DMRT3 JASPAR yes 115384890
chr14 53392918 53392936 IRF2 JASPAR yes 107549681
chr14 53392918 53392936 IRF2 JASPAR yes 115384891
chr14 53392922 53392936 STAT1 JASPAR yes 107549682
chr14 53392922 53392936 STAT1 JASPAR yes 115384892
chr14 53392923 53392938 IRF9 JASPAR yes 107549683
chr14 53392923 53392938 IRF9 JASPAR yes 115384893
chr14 53392929 53392939 NFATC3 JASPAR yes 107549684
chr14 53392929 53392939 NFATC3 JASPAR yes 115384894
chr14 53392930 53392937 NFATC2 JASPAR yes 107549685
chr14 53392930 53392937 NFATC2 JASPAR yes 115384895
chr14 53392934 53392944 MAX JASPAR yes 107549686
chr14 53392934 53392944 MAX JASPAR yes 115384896
chr14 53392944 53392958 ONECUT2 JASPAR yes 107549687
chr14 53392944 53392958 ONECUT3 JASPAR yes 107549688
chr14 53392944 53392958 ONECUT2 JASPAR yes 115384897
chr14 53392944 53392958 ONECUT3 JASPAR yes 115384898
chr14 53392954 53392965 PROP1 JASPAR yes 107549689
chr14 53392954 53392965 PROP1 JASPAR yes 115384899
chr14 53392962 53392965 MYB TRANSFAC yes 107549690
chr14 53392962 53392965 MYB TRANSFAC yes 115384900
chr14 53392973 53392984 STAT1 JASPAR yes 107549691
chr14 53392973 53392984 STAT1 JASPAR yes 115384901
SNP sites on vista17789[chr14:53392802-53392977]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr14 53392867 rs59388902 A AAAAGGAAAATGGTTATCTAC
DUX4 MAFF MAFK
3544604
chr14 53392877 rs114217980 C T no 3544605
chr14 53392973 rs114671381 T A
STAT1
3544606
Genes possibly regulated by vista17789[chr14:53392802-53392977]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr14 53323986 53419153 - FERMT2 ENSG00000073712.9 53419153 0.76 0.99 13323 73824
Expression level of Genes
Back to top
miRNAs possibly regulated by vista17789[chr14:53392802-53392977]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results