Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 53382525 53394755 enh15618
chr14 53392802 53392977 vista17789

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 53392867 rs59388902 A AAAAGGAAAATGGTTATCTAC 3544604

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results