EnhancerDB
  1. Home
  2. Enhancers
  3. vista4187[chr1:183762956-183763089]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista4187[chr1:183762956-183763089]
Back to top
Tissue distribution of vista4187
Back to top
Transcription factor that possibly regulate vista4187[chr1:183762956-183763089]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr1 183762951 183762963 POU2F1 JASPAR yes 33704691
chr1 183762951 183762963 POU2F1 JASPAR yes 118413110
chr1 183762951 183762965 POU1F1 JASPAR yes 33704692
chr1 183762951 183762965 POU1F1 JASPAR yes 118413111
chr1 183762953 183762963 NFATC3 JASPAR yes 33704693
chr1 183762953 183762963 NFATC3 JASPAR yes 118413112
chr1 183762955 183762962 NFATC2 JASPAR yes 33704694
chr1 183762955 183762962 NFATC2 JASPAR yes 118413113
chr1 183762956 183762964 FOXO3 JASPAR yes 33704695
chr1 183762956 183762964 FOXO3 JASPAR yes 118413114
chr1 183762970 183762985 FOXP1 JASPAR yes 33704696
chr1 183762970 183762985 FOXP1 JASPAR yes 118413115
chr1 183762976 183762982 TBP TRANSFAC yes 33704697
chr1 183762976 183762982 TBP TRANSFAC yes 118413116
chr1 183763032 183763036 YY1 TRANSFAC yes 33704698
chr1 183763032 183763036 YY1 TRANSFAC yes 118413117
chr1 183763036 183763041 GATA2 JASPAR yes 33704699
chr1 183763036 183763041 GATA2 JASPAR yes 118413118
chr1 183763042 183763047 ETS2 TRANSFAC yes 33704700
chr1 183763042 183763047 ETS2 TRANSFAC yes 118413119
chr1 183763043 183763057 STAT1 JASPAR yes 33704701
chr1 183763043 183763057 STAT1 JASPAR yes 118413120
chr1 183763047 183763052 ETS2 TRANSFAC yes 33704702
chr1 183763047 183763052 ETS2 TRANSFAC yes 118413121
chr1 183763047 183763055 FEV JASPAR yes 33704703
chr1 183763047 183763055 FEV JASPAR yes 118413122
chr1 183763057 183763071 TCF7L2 JASPAR yes 33704704
chr1 183763057 183763071 TCF7L2 JASPAR yes 118413123
chr1 183763057 183763072 LEF1 JASPAR yes 33704705
chr1 183763057 183763072 LEF1 JASPAR yes 118413124
chr1 183763061 183763069 LEF1 TRANSFAC yes 33704706
chr1 183763061 183763069 LEF1 TRANSFAC yes 118413125
chr1 183763065 183763070 ETS2 TRANSFAC yes 33704707
chr1 183763065 183763070 ETS2 TRANSFAC yes 118413126
chr1 183763065 183763073 FEV JASPAR yes 33704708
chr1 183763065 183763073 FEV JASPAR yes 118413127
chr1 183763069 183763081 POU3F2 JASPAR yes 33704709
chr1 183763069 183763081 POU3F2 JASPAR yes 118413128
chr1 183763069 183763082 POU3F3 JASPAR yes 33704710
chr1 183763069 183763082 POU3F3 JASPAR yes 118413129
SNP sites on vista4187[chr1:183762956-183763089]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr1 183762988 rs73043331 A G no 782704
chr1 183763040 rs572227220 CCAAAGGAAAGGAAATCAGTATAT C
GATA2
782705
chr1 183763056 rs536138528 C A,T
STAT1
782706
chr1 183763083 rs115611738 G A no 782707
Genes possibly regulated by vista4187[chr1:183762956-183763089]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by vista4187[chr1:183762956-183763089]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results