EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr1:183763036-183763041]
Chromosome characteristics of GATA2[chr1:183763036-183763041]
Back to top
Enhancers possibly regulated by GATA2[chr1:183763036-183763041]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 183761365 183766055 enh50093
Large Intestine
chr1 183762956 183763089 vista4187
VISTA
SNP sites on GATA2[chr1:183763036-183763041]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 183763040 rs572227220 CCAAAGGAAAGGAAATCAGTATAT C 782705
Genes possibly regulated by GATA2[chr1:183763036-183763041]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA2[chr1:183763036-183763041]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results