EnhancerDB
  1. Home
  2. Enhancers
  3. vista50368[chr5:179038504-179038699]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista50368[chr5:179038504-179038699]
Back to top
Tissue distribution of vista50368
Back to top
Transcription factor that possibly regulate vista50368[chr5:179038504-179038699]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr5 179036088 179041347 POLR2A UCSC Txn Factor no Conserved 108537757
chr5 179038518 179038532 TLX1 JASPAR yes 68184399
chr5 179038518 179038532 TLX1 JASPAR yes 70772942
chr5 179038518 179038536 ESR2 JASPAR yes 68184400
chr5 179038518 179038536 ESR2 JASPAR yes 70772943
chr5 179038519 179038536 ESR1 JASPAR yes 68184401
chr5 179038519 179038536 ESR1 JASPAR yes 70772944
chr5 179038536 179038551 RFX5 JASPAR yes 68184402
chr5 179038536 179038551 RFX5 JASPAR yes 70772945
chr5 179038544 179038547 MYB TRANSFAC yes 68184403
chr5 179038544 179038547 MYB TRANSFAC yes 70772946
chr5 179038554 179038558 TEAD2 TRANSFAC yes 68184404
chr5 179038554 179038558 TEAD2 TRANSFAC yes 70772947
chr5 179038557 179038577 TP63 JASPAR yes 68184405
chr5 179038557 179038577 TP63 JASPAR yes 70772948
chr5 179038562 179038583 REST JASPAR yes 68184406
chr5 179038562 179038583 REST JASPAR yes 70772949
chr5 179038563 179038582 REST JASPAR yes 68184407
chr5 179038563 179038582 REST JASPAR yes 70772950
chr5 179038568 179038578 SP1 JASPAR yes 68184408
chr5 179038568 179038578 SP1 JASPAR yes 70772951
chr5 179038571 179038580 HIC2 JASPAR yes 68184409
chr5 179038571 179038580 HIC2 JASPAR yes 70772952
chr5 179038589 179038593 YY1 TRANSFAC yes 68184410
chr5 179038589 179038593 YY1 TRANSFAC yes 70772953
chr5 179038596 179038612 SOX4 JASPAR yes 68184411
chr5 179038596 179038612 SOX4 JASPAR yes 70772954
chr5 179038608 179038619 CEBPB JASPAR yes 68184412
chr5 179038608 179038619 CEBPB JASPAR yes 70772955
chr5 179038611 179038623 YY1 JASPAR yes 68184413
chr5 179038611 179038623 YY1 JASPAR yes 70772956
chr5 179038633 179038651 RARA JASPAR yes 68184414
chr5 179038633 179038651 RARA JASPAR yes 70772957
chr5 179038640 179038653 NR2F1 JASPAR yes 68184415
chr5 179038640 179038653 NR2F1 JASPAR yes 70772958
chr5 179038644 179038652 CREB1 JASPAR yes 68184416
chr5 179038644 179038652 CREB1 JASPAR yes 70772959
chr5 179038648 179038658 SREBF2 JASPAR yes 68184417
chr5 179038648 179038658 SREBF2 JASPAR yes 70772960
chr5 179038648 179038659 USF1 JASPAR yes 68184418
chr5 179038648 179038659 USF2 JASPAR yes 68184419
chr5 179038648 179038659 USF1 JASPAR yes 70772961
chr5 179038648 179038659 USF2 JASPAR yes 70772962
chr5 179038651 179038664 NFKB1 JASPAR yes 68184420
chr5 179038651 179038664 NFKB1 JASPAR yes 70772963
chr5 179038656 179038662 ZNF354C JASPAR yes 68184421
chr5 179038656 179038662 ZNF354C JASPAR yes 70772964
chr5 179038680 179038691 CEBPB JASPAR yes 68184422
chr5 179038680 179038691 CEBPB JASPAR yes 70772965
SNP sites on vista50368[chr5:179038504-179038699]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr5 179038515 rs140617908 G A,T
POLR2A
8745424
chr5 179038535 rs11270138 T TCTGCCTCCTGGGTTCAAGCAATTCTCCC
ESR1 ESR2 POLR2A
8745425
chr5 179038535 rs71001013 T TCTGCCTCCTGGGTTCAAGCAATTCTCCC
ESR1 ESR2 POLR2A
8745426
chr5 179038591 rs201229105 A AT
POLR2A YY1
8745427
chr5 179038606 rs142194139 C A
POLR2A SOX4
8745428
Genes possibly regulated by vista50368[chr5:179038504-179038699]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr5 178977559 179037027 + RUFY1 ENSG00000176783.10 178977559 0.68 0.99 6060 39055
chr5 179041179 179061785 - HNRNPH1 ENSG00000169045.13 179061785 0.84 0.99 6061 76914
chr5 179068545 179072047 - C5orf60 ENSG00000204661.5 179072047 0.97 0.89 6062 66652
chr5 179078298 179079445 + AC136604.1 ENSG00000228259.2 179078298 0.0 0.0 6063 60401
chr5 179105584 179107975 - CBY3 ENSG00000204659.4 179107975 0.7 1.0 6064 30724
chr5 179105629 179157926 + CANX ENSG00000127022.10 179105629 0.71 1.0 6065 33070
Expression level of Genes
Back to top
miRNAs possibly regulated by vista50368[chr5:179038504-179038699]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results