Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 179030585 179044455 enh66152
chr5 179038504 179038699 vista50368

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 179038535 rs11270138 T TCTGCCTCCTGGGTTCAAGCAATTCTCCC 8745425
chr5 179038535 rs71001013 T TCTGCCTCCTGGGTTCAAGCAATTCTCCC 8745426

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results