EnhancerDB
  1. Home
  2. Enhancers
  3. vista61794[chr9:33017262-33017602]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista61794[chr9:33017262-33017602]
Back to top
Tissue distribution of vista61794
Back to top
Transcription factor that possibly regulate vista61794[chr9:33017262-33017602]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr9 33017285 33017289 YY1 TRANSFAC yes 95344695
chr9 33017297 33017301 TEAD2 TRANSFAC yes 95344696
chr9 33017299 33017302 MYB TRANSFAC yes 95344697
chr9 33017307 33017311 YY1 TRANSFAC yes 95344698
chr9 33017310 33017313 MYB TRANSFAC yes 95344699
chr9 33017322 33017334 FOXI1 JASPAR yes 95344700
chr9 33017340 33017344 YY1 TRANSFAC yes 95344701
chr9 33017347 33017351 YY1 TRANSFAC yes 95344702
chr9 33017360 33017371 NFKB1 JASPAR yes 95344703
chr9 33017361 33017371 RELA JASPAR yes 95344704
chr9 33017361 33017371 REL JASPAR yes 95344705
chr9 33017381 33017391 TFAP4 JASPAR yes 95344706
chr9 33017409 33017422 ELF3 JASPAR yes 95344707
chr9 33017410 33017421 ELF5 JASPAR yes 95344708
chr9 33017410 33017422 EHF JASPAR yes 95344709
chr9 33017410 33017422 ELF1 JASPAR yes 95344710
chr9 33017410 33017423 ELF1 JASPAR yes 95344711
chr9 33017433 33017437 NFE TRANSFAC yes 95344712
chr9 33017486 33017490 LFA1 TRANSFAC yes 95344713
chr9 33017490 33017499 PITX3 JASPAR yes 95344714
chr9 33017490 33017500 GSC2 JASPAR yes 95344715
chr9 33017490 33017500 GSC JASPAR yes 95344716
chr9 33017491 33017499 OTX1 JASPAR yes 95344717
chr9 33017495 33017507 CREB1 JASPAR yes 95344718
chr9 33017497 33017511 ATF7 JASPAR yes 95344719
chr9 33017500 33017505 ATF1 TRANSFAC yes 95344720
chr9 33017546 33017551 TFAP2A TRANSFAC yes 95344721
chr9 33017546 33017552 MZF1 JASPAR yes 95344722
chr9 33017547 33017557 NFKB1 JASPAR yes 95344723
chr9 33017547 33017557 RELA JASPAR yes 95344724
chr9 33017547 33017557 REL JASPAR yes 95344725
chr9 33017547 33017558 NFKB1 JASPAR yes 95344726
chr9 33017548 33017558 RELA JASPAR yes 95344727
chr9 33017550 33017555 H4TF1 TRANSFAC yes 95344728
chr9 33017555 33017559 H1TF2 TRANSFAC yes 95344729
chr9 33017555 33017559 NFE TRANSFAC yes 95344730
chr9 33017555 33017559 SRF TRANSFAC yes 95344731
chr9 33017577 33017589 FOXI1 JASPAR yes 95344732
SNP sites on vista61794[chr9:33017262-33017602]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr9 33017299 rs540714593 A G
MYB TEAD2
10994133
chr9 33017343 rs192949825 T C
YY1
10994134
chr9 33017381 rs7852206 T C
TFAP4
10994135
chr9 33017483 rs75667681 G T no 10994136
chr9 33017491 rs558418273 A G
GSC GSC2 OTX1 PITX3
10994137
chr9 33017505 rs370484983 G GTCAC,GTCACTAGTCACTTCCCAAAGGGCAC
ATF1 ATF7 CREB1
10994138
chr9 33017528 rs187133710 T G no 10994139
chr9 33017530 rs79917094 T C no 10994140
chr9 33017574 rs74397978 T C no 10994141
Genes possibly regulated by vista61794[chr9:33017262-33017602]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr9 32972604 33025166 - APTX ENSG00000137074.14 33025166 0.76 0.99 8878 92436
chr9 33025209 33039905 + DNAJA1 ENSG00000086061.11 33025209 0.66 0.98 8879 92393
chr9 33041762 33076665 - SMU1 ENSG00000122692.7 33076665 0.65 1.0 8880 40937
Expression level of Genes
Back to top
miRNAs possibly regulated by vista61794[chr9:33017262-33017602]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results