Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 33017262 33017602 vista61794

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 33017505 rs370484983 G GTCAC,GTCACTAGTCACTTCCCAAAGGGCAC 10994138

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results