EnhancerDB

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chrom.	Start	End	TF Name	Source	Predicted site?	Tissue/Cell line	id
chr10	94607940	94608884	POLR2A	UCSC Txn Factor	no	Conserved	107931526
chr10	94608180	94608892	PHF8	UCSC Txn Factor	no	Conserved	107931527
chr10	94608797	94609097	EGR1	UCSC Txn Factor	no	Conserved	107931543
chr10	94608866	94609045	TEAD4	UCSC Txn Factor	no	Conserved	107931548
chr10	94608890	94608901	E2F1	JASPAR	yes		21134852
chr10	94608891	94608902	E2F4	JASPAR	yes		21134853
chr10	94608891	94608902	E2F6	JASPAR	yes		21134854
chr10	94608908	94608929	ZNF263	JASPAR	yes		21134855
chr10	94608913	94608923	MZF1	JASPAR	yes		21134856
chr10	94608915	94608929	PLAG1	JASPAR	yes		21134857
chr10	94608928	94608939	NRF1	JASPAR	yes		21134858
chr10	94608989	94609001	NHLH1	JASPAR	yes		21134859
chr10	94608990	94609000	MSC	JASPAR	yes		21134860
chr10	94608990	94609000	NHLH1	JASPAR	yes		21134861
chr10	94609002	94609017	RFX5	JASPAR	yes		21134862
chr10	94609015	94609035	ESR1	JASPAR	yes		21134863
chr10	94609020	94609035	ESR2	JASPAR	yes		21134864
chr10	94609021	94609032	ESRRA	JASPAR	yes		21134865
chr10	94609028	94609043	ZBTB33	JASPAR	yes		21134866
chr10	94609031	94609046	ZBTB33	JASPAR	yes		21134867

chrom	Position	dbSNP ID	Reference Allele	Alternative Allele	is SNP in TFBS	id
chr10	94608925	rs61860812	C	T	EGR1 PLAG1 TEAD4 ZNF263	1583555
chr10	94608939	rs2497331	C	G	EGR1 NRF1 TEAD4	1583556
chr10	94608946	rs557999303	CGAGAAGAGAGCGTGGGCTG	C	EGR1 TEAD4	1583557

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	Strand	Gene Name	Ensembl ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance between enhancer and TSS	id	More
chr10	94590935	94819250	+	EXOC6	ENSG00000138190.12	94590935	0.71	0.97	10029	82051

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	Strand	miRNA Name	miRBase ID	TSS	Score	TSI of Normal tissues	TSI of Cancer tissues	id	More

No results