Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 94608884 94609046 vista8341

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 94608925 rs61860812 C T 1583555
chr10 94608939 rs2497331 C G 1583556
chr10 94608946 rs557999303 CGAGAAGAGAGCGTGGGCTG C 1583557

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results