Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 14329245 14342582 enh23052

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 14342091 rs559257067 ATTAAAACTCTTTTTTTTTT A 8851570
chr6 14342098 rs114380621 C T 8851571

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results