Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 15789685 15799315 enh23071

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 15792953 rs367698103 TGAGTCAGGCCAGTTCTCTCG T 8864847
chr6 15792953 rs72142491 TGAGTCAGGCCAGTTCTCTCG T 8864848

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results