Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 17690272 17694595 enh72185

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 17690501 rs146486464 T TGAACCCGGGTGGCGTAGCTTGCAGTGA 8878625

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results