Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 24943405 24954235 enh49065

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 24950035 rs146984980 CCCTGGGTGCTATAGCCCACCA C 8917357
chr6 24950035 rs68041572 CCCTGGGTGCTATAGCCCACCA C 8917358

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results