Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 25261805 25268274 enh84137

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 25262398 rs552317998 GGCAAGCAAAAACAACAAAAA G 8920976

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results