Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 27756956 27766255 enh61372

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 27764691 rs551991235 GTTTTATTTTATTTTATTTTA G 8933826

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results