Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 29714385 29723035 enh91682

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 29721928 rs375033580 CCTCCTGGGTTCACGCCATT C 8941108

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results