EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr6:29759739-29759750]
Chromosome characteristics of TFAP2C[chr6:29759739-29759750]
Back to top
Enhancers possibly regulated by TFAP2C[chr6:29759739-29759750]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 29754552 29768715 enh23145
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Bone (Osteoblast) Placenta Colon (HCT116) Lung (PC-9)
SNP sites on TFAP2C[chr6:29759739-29759750]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 29759743 rs116684298 C T 8941576
chr6 29759750 rs1611203 G A,C 8941577
chr6 29759750 rs566479416 G GCA,GGCTCTCAGGGCCTCAGGCA 8941578
Genes possibly regulated by TFAP2C[chr6:29759739-29759750]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr6:29759739-29759750]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results