EnhancerDB
  1. Home
  2. TFBS
  3. ZNF410[chr6:31335689-31335706]
Chromosome characteristics of ZNF410[chr6:31335689-31335706]
Back to top
Enhancers possibly regulated by ZNF410[chr6:31335689-31335706]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 31332385 31336895 enh100494
Uterus
SNP sites on ZNF410[chr6:31335689-31335706]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 31335695 rs71552049 TTGTGTGGTAGAACTTCCCATAG T 8956647
chr6 31335703 rs61292951 T C 8956648
Genes possibly regulated by ZNF410[chr6:31335689-31335706]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF410[chr6:31335689-31335706]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results