Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 36963565 36968335 enh66202

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 36966353 rs142041244 G A 8997633
chr6 36966362 rs199871140 GCCTGGCACAAGCCTTGCCCAAT G 8997634

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results