Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 39438325 39442495 enh95711

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 39440657 rs149160797 ATGGAGTTTCACTCTTGCTGCCCAGGC A 9013196
chr6 39440659 rs548363833 G A 9013197
chr6 39440674 rs9369118 C T 9013198

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results