Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 40361185 40370055 enh63537

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 40368913 rs141968686 A AGCCTCCAGGAAGAGCCTATGG 9018401
chr6 40368913 rs374899308 A AGCCTCCAGGAAGAGCCTATGG 9018402

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results