| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 40948694 | 40953723 | enh72243 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 40949612 | rs141213019 | TGGTGGGCACCTGCAATCCCAGCTACTCA | T | 9022800 | |
| chr6 | 40949612 | rs70984184 | TGGTGGGCACCTGCAATCCCAGCTACTCA | T | 9022801 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|