Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 40948694 40953723 enh72243

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 40949612 rs141213019 TGGTGGGCACCTGCAATCCCAGCTACTCA T 9022800
chr6 40949612 rs70984184 TGGTGGGCACCTGCAATCCCAGCTACTCA T 9022801

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results