Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 41400933 41405083 enh72245

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 41403232 rs546770558 ATTTATTTTTTTCGCTCAGATTG A 9025042
chr6 41403232 rs79390607 ATTTATTTTTTTCGCTCAGATTG A 9025043

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results