Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 43231385 43237175 enh66209

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 43236705 rs560633167 ACCCTTTGAGGTGGGCACCATTATGACC A 9036494

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results