Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 44184085 44192635 enh23260

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 44191762 rs11274220 GAGGCTCGCGAGCGGAGGTGC G 9043446
chr6 44191762 rs398065753 GAGGCTCGCGAGCGGAGGTGC G 9043447

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results