Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 47367935 47377835 enh55775

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 47368090 rs11274558 TGTACTCCTGTACATTATATAA T 9061997
chr6 47368090 rs60142875 TGTACTCCTGTACATTATATAA T 9061998

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results