Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 83659125 83675495 enh9218

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 83668088 rs535984776 A ATGTATATAATATTTATATTGG 9162811

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results