Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 90203968 90213218 enh72349

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 90205010 rs555387681 ATGATTTGGCATGAACCCCATGACTCGGGG A 9183585

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results