Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 107855465 107868915 enh9293

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 107867912 rs575722013 GAAAAACAAAACAAACAAACA G 9241679

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results