Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 135541885 135556775 enh39535

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 135547292 rs560402358 AACTCATTTATTTATTCAACAAATATTTACTG A 9358605

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results