Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 137950537 137964895 enh23659

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 137958707 rs559550605 ATTATATGGAGTTGGTTTTGT A 9370910

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results