Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 138186725 138198095 enh23664

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 138188622 rs529176918 GCCCGGAGAGGTAACCGCCGCGCCT G 9373533

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 138188351 138204449 + TNFAIP3 ENSG00000118503.10 138188351 0.77 0.98 267 6991


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results