Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89056187 89062055 enh47988
chr16 89057397 89061023 vista669

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89058880 rs565847401 C T 4671044
chr16 89058908 rs560653210 G A 4671045
chr16 89058930 rs536070894 G A,T 4671046
chr16 89059080 rs553999235 C G 4671047
chr16 89059082 rs11356515 AG A 4671048
chr16 89059082 rs397789178 AG A 4671049
chr16 89059086 rs545772597 C T 4671050
chr16 89059178 rs140808716 C T 4671051
chr16 89059213 rs567903476 TCCCATCAGCTGCCTGGGTGGGCTCCCAGCCC T 4671052
chr16 89059225 rs144587076 C T 4671053

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results