EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:3420591-3421107]
Chromosome characteristics of ZZZ3[chr1:3420591-3421107]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:3420591-3421107]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3416785 3420935 enh110633
Cervix (HeLa-S3)
chr1 3420761 3421065 vista116
VISTA
SNP sites on ZZZ3[chr1:3420591-3421107]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3420639 rs189220436 G A,T 22529
chr1 3420665 rs558021464 ATGGCCCCAGGGGAGGCAGAGGAGGGGGC A 22530
chr1 3420671 rs575428125 C A 22531
chr1 3420748 rs72852481 G A 22532
chr1 3420817 rs116728185 T C 22533
chr1 3420879 rs149384874 C T 22534
chr1 3420903 rs143709003 G A,T 22535
chr1 3420985 rs114678287 G A 22536
Genes possibly regulated by ZZZ3[chr1:3420591-3421107]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:3420591-3421107]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results