EnhancerDB
  1. Home
  2. TFBS
  3. EZH2[chr1:17025206-17028605]
Chromosome characteristics of EZH2[chr1:17025206-17028605]
Back to top
Enhancers possibly regulated by EZH2[chr1:17025206-17028605]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 17024091 17046215 enh11549
Kidney Brain (SK-N-SH) Prostate (RWPE1) Placenta Colon (HCT116) Thyroid Pancreas Blood (T-cell) Epithelial (MCF-7)
chr1 17027024 17027386 vista542
VISTA
SNP sites on EZH2[chr1:17025206-17028605]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 17025261 rs34483089 T TA 113567
chr1 17025261 rs397785800 T TA 113568
chr1 17025299 rs535813814 G A 113569
chr1 17025369 rs569962990 T G 113570
chr1 17025552 rs66996520 T TC 113571
chr1 17025589 rs540732547 G A 113572
chr1 17025690 rs536183 C T 113573
chr1 17025706 rs116128043 C T 113574
chr1 17025828 rs2610624 G C 113575
chr1 17025951 rs566773981 C T 113576
chr1 17025951 rs570730210 C CGCA 113577
chr1 17026006 rs527855413 C T 113578
chr1 17026046 rs547108253 A T 113579
chr1 17026253 rs569542195 G T 113580
chr1 17026304 rs9725055 G A 113581
chr1 17026433 rs560743564 G T 113582
chr1 17026652 rs139977165 C A 113583
chr1 17026802 rs567368 C G 113584
chr1 17026803 rs567371 C T 113585
chr1 17027026 rs531983961 G A 113586
chr1 17027205 rs565869956 C T 113587
chr1 17027279 rs548448780 G A,C 113588
chr1 17027292 rs568249561 C T 113589
chr1 17027317 rs190892467 G C 113590
chr1 17027404 rs538694946 G A 113591
chr1 17027434 rs145697590 C T 113592
chr1 17027534 rs541317149 G A 113593
chr1 17027867 rs532219005 C G 113594
chr1 17027930 rs2476565 G C 113595
chr1 17027930 rs534864027 G GGGAGGGGCACACACAGCCGGGAGGGACGCACACAGCCC 113596
chr1 17027930 rs58689450 G GGGAGGGGCACACACAGCCGGGAGGGACGCACACAGCCC 113597
chr1 17028090 rs115598762 C T 113598
chr1 17028114 rs568285951 A G 113599
chr1 17028175 rs550739161 T G 113600
chr1 17028194 rs570083153 T C 113601
chr1 17028246 rs28662418 T C 113602
chr1 17028507 rs576912153 G A 113603
chr1 17028572 rs545873618 C G 113604
chr1 17028573 rs559399254 C T 113605
Genes possibly regulated by EZH2[chr1:17025206-17028605]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by EZH2[chr1:17025206-17028605]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results