EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr1:24721348-24722767]
Chromosome characteristics of TCF7L2[chr1:24721348-24722767]
Back to top
Enhancers possibly regulated by TCF7L2[chr1:24721348-24722767]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 24704149 24722895 enh138
Prostate (PC-3) Prostate (RWPE1) Esophagus Astrocyte Placenta Thyroid Peripheral Blood (MM.1S) Blood (Karpas-422) Stomach
chr1 24722613 24722643 vista777
VISTA
SNP sites on TCF7L2[chr1:24721348-24722767]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 24721359 rs72880676 A G 165355
chr1 24721702 rs558688353 T C 165356
chr1 24721770 rs116708574 G A 165357
chr1 24721868 rs376699971 TAAATATGTGGGTAAATAGA T 165358
chr1 24721945 rs6658381 C T 165359
chr1 24722047 rs371730879 C T 165360
chr1 24722068 rs184802609 G A 165361
chr1 24722077 rs190301785 C A 165362
chr1 24722307 rs113270104 G T 165363
chr1 24722398 rs11249099 A G 165364
chr1 24722472 rs397979658 C CA 165365
chr1 24722472 rs561611881 C CA 165366
chr1 24722472 rs58022759 CA C 165367
chr1 24722472 rs71029545 C CA 165368
chr1 24722472 rs796395028 CA C 165369
chr1 24722703 rs114724445 C T 165370
Genes possibly regulated by TCF7L2[chr1:24721348-24722767]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr1:24721348-24722767]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results