EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:27151681-27156053]
Chromosome characteristics of ZNF274[chr1:27151681-27156053]
Back to top
Enhancers possibly regulated by ZNF274[chr1:27151681-27156053]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 27154485 27154771 vista885
VISTA
chr1 27154983 27155478 vista886
VISTA
SNP sites on ZNF274[chr1:27151681-27156053]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 27151696 rs546511873 A G 182392
chr1 27151711 rs539375041 T A 182393
chr1 27151720 rs140970286 C T 182394
chr1 27151733 rs79488247 T C 182395
chr1 27151913 rs538305632 C G 182396
chr1 27151990 rs182930033 C A 182397
chr1 27152025 rs573731325 G C 182398
chr1 27152043 rs61786516 C T 182399
chr1 27152255 rs186652100 G A 182400
chr1 27152409 rs139294982 T C 182401
chr1 27152611 rs189772487 T C 182402
chr1 27152812 rs143204146 A G 182403
chr1 27153463 rs568455037 C G 182404
chr1 27153703 rs112408368 A G 182405
chr1 27153855 rs187175194 G T 182406
chr1 27153958 rs2273015 G A 182407
chr1 27154141 rs74405694 A G 182408
chr1 27154316 rs376460466 GT G 182409
chr1 27154385 rs542820668 G GC 182410
chr1 27154397 rs149251018 A T 182411
chr1 27154470 rs76133297 G A 182412
chr1 27154701 rs376540038 C T 182413
chr1 27154710 rs371041511 C T 182414
chr1 27154831 rs577058903 C T 182415
chr1 27154970 rs117664140 C T 182416
chr1 27155044 rs144425033 A G 182417
chr1 27155150 rs148398744 A G 182418
chr1 27155166 rs60314236 C T 182419
chr1 27155243 rs531388541 AAGCTCTGGGGGGCCCAGAGCTC A 182420
chr1 27155257 rs77743440 C T 182421
chr1 27155274 rs112510910 G A 182422
chr1 27155489 rs531963941 G A 182423
chr1 27155669 rs183669397 C G 182424
chr1 27155747 rs78169804 G T 182425
chr1 27155843 rs534114209 C T 182426
chr1 27155913 rs180824965 G A 182427
chr1 27155932 rs139939976 G A 182428
Genes possibly regulated by ZNF274[chr1:27151681-27156053]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 27153201 27184093 + ZDHHC18 ENSG00000204160.7 27153201 0.75 1.0 1520 375
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr1:27151681-27156053]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results